Skip to main content

pCB163
(Plasmid #37388)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37388 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE
  • Modifications to backbone
    This contains a blasticidin resistance gene for selection in eukaryotic cells.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dynactin 2
  • Alt name
    p50
  • Alt name
    DCTN2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1206
  • Mutation
    A7P
  • Entrez Gene
    DCTN2 (a.k.a. DCTN50, DYNAMITIN, HEL-S-77, RBP50)
  • Tags / Fusion Proteins
    • TEV (N terminal on insert)
    • S-tag (N terminal on insert)
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    IMAGE, 4303142
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified single nucleotide mismatches at bp# 2273 & 2347 when compared to the full plasmid sequence provided by the depositing laboratory. The mismatch at bp#2273 causes A7P mutation in the DCTN2 seqeuence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB163 was a gift from Iain Cheeseman (Addgene plasmid # 37388 ; http://n2t.net/addgene:37388 ; RRID:Addgene_37388)
  • For your References section:

    Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Kiyomitsu T, Cheeseman IM. Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440. 10.1038/ncb2440 PubMed 22327364