Skip to main content

pCB169
(Plasmid #37390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37390 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE
  • Modifications to backbone
    This contains a blasticidin resistance gene for selection in eukaryotic cells.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dynein light chain TcTex-type 3
  • Alt name
    DYNLT3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    351
  • Entrez Gene
    DYNLT3 (a.k.a. RP3, TCTE1L, TCTEX1L)
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • TEV (N terminal on insert)
    • S-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    IMAGE, 3448623

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB169 was a gift from Iain Cheeseman (Addgene plasmid # 37390 ; http://n2t.net/addgene:37390 ; RRID:Addgene_37390)
  • For your References section:

    Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Kiyomitsu T, Cheeseman IM. Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440. 10.1038/ncb2440 PubMed 22327364