Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

6X-STAT-synthetic luciferase
(Plasmid #37392)


Item Catalog # Description Quantity Price (USD)
Plasmid 37392 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8904
  • Vector type
    Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    six STAT consensus sites
  • Alt name
  • Species
  • Promoter Hsp70

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pUAST-5 (5'-CTGCAACTAAAATCTGCCAAGAAG-3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Perrimon Lab plasmid #445

To generate a reporter construct containing six STAT consensus
sites (TCCNNNGGA), two pairs of oligos—(1) TTCTGGGAAACCGTTTATACGCTGCGTTCGCGGAAACCGTTTATACGCTGCGTTCTGGGAAACCGTTTATAC, AACGGTTTCCCAGAACGCAGCGTATAAACGGTTTCCGCGAACGCAGCGTATAAACGGTTTCCCAGAATGCA and (2) GCTGCGTTCGCGGAAACCGTTTATACGCTGCGTTCTGGGAAACCGTTTATACGCTGCGTTCGCGGAA, AATTTTCCGCGAACGCAGCGTATAAACGGTTTCCCAGAACGCAGCGTATAAACGGTTTCCGCGAACGCAGCGTATA—were annealed, respectively, and cloned together into pUAST. Subsequently, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) and the hsp70 minimal promoter were subcloned into the resulting vector using XhoI/XbaI and NotI/XhoI sites, respectively, to generate the 6XSTAT–synthetic-luc construct.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6X-STAT-synthetic luciferase was a gift from Norbert Perrimon (Addgene plasmid # 37392 ; ; RRID:Addgene_37392)
  • For your References section:

    Genome-wide RNAi analysis of JAK/STAT signaling components in Drosophila. Baeg GH, Zhou R, Perrimon N. Genes Dev. 2005 Aug 15;19(16):1861-70. Epub 2005 Jul 29. 10.1101/gad.1320705 PubMed 16055650