pTK23
(Plasmid
#37405)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNeuromodulin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)60
-
MutationContains the first 20aa of GAP43 (neuromodulin)
-
Entrez GeneGAP43 (a.k.a. B-50, PP46)
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- TEV (N terminal on insert)
- S-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK23 was a gift from Iain Cheeseman (Addgene plasmid # 37405 ; http://n2t.net/addgene:37405 ; RRID:Addgene_37405) -
For your References section:
Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Kiyomitsu T, Cheeseman IM. Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440. 10.1038/ncb2440 PubMed 22327364