-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CA-FLEX
-
Backbone manufacturerMitsuko Watabe-Uchida
- Backbone size w/o insert (bp) 6058
- Total vector size (bp) 7794
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRabies virus glycoprotein
-
Alt nameRG
-
Speciesrabies virus
-
Insert Size (bp)1574
-
GenBank IDM31046.1
- Promoter CA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CCTACAGCTCCTGGGCAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEdward M. Callaway
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CA-FLEX-RG was a gift from Naoshige Uchida (Addgene plasmid # 38043 ; http://n2t.net/addgene:38043 ; RRID:Addgene_38043) -
For your References section:
Whole-brain mapping of direct inputs to midbrain dopamine neurons. Watabe-Uchida M, Zhu L, Ogawa SK, Vamanrao A, Uchida N. Neuron. 2012 Jun 7;74(5):858-73. 10.1016/j.neuron.2012.03.017 PubMed 22681690