pCEFL
(Plasmid
#38121)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNAIIIB
-
Backbone manufacturerinvitrogen
- Backbone size (bp) 6000
-
Modifications to backboneCMV-promoter removed and EF-1 promoter added pCDNAIII sequence from the Hind III site to the Nru I site
-
Vector typeMammalian Expression
- Promoter EF-1
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer sp6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GG1487 insert, CA2074GC, these nucleotide changes should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL was a gift from JS Gutkind (Addgene plasmid # 38121 ; http://n2t.net/addgene:38121 ; RRID:Addgene_38121)