pCEFL KZ HA
(Plasmid
#38122)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCEFL
-
Backbone manufacturerGutkind Lab
- Backbone size (bp) 6051
-
Vector typeMammalian Expression
- Promoter EF-1
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer sp6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
polylinker sequence to add kozak sequence and HA tag at Bam HI site
AAGCTTCTCGAGgccgccaccatgggatccaccatgtacgacgttcctgattacgctagcctcccgagatctcctgaattc
A1486G, CA2100GC, GG2314CC, these changes should have no effect on plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL KZ HA was a gift from JS Gutkind (Addgene plasmid # 38122 ; http://n2t.net/addgene:38122 ; RRID:Addgene_38122)