Skip to main content

pEGFP-N1-MITF-M
(Plasmid #38131)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38131 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5963
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MITF-M
  • Alt name
    microphthalmia transcription factor, M variant
  • Alt name
    MITF variant 5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1247
  • Mutation
    deleted stop codon
  • GenBank ID
    NM_198158.2
  • Entrez Gene
    MITF (a.k.a. CMM8, COMMAD, MI, MITF-A, WS2, WS2A, bHLHe32)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that while MITF isoforms 4 and 5 can both be referred to as MITF-M, this construct contains MITF isoform 5.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-MITF-M was a gift from Shawn Ferguson (Addgene plasmid # 38131 ; http://n2t.net/addgene:38131 ; RRID:Addgene_38131)
  • For your References section:

    The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. Sci Signal. 2012 Jun 12;5(228):ra42. 10.1126/scisignal.2002790 PubMed 22692423