-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA4/myc-His A
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 9100
-
Modifications to backbone"AAGCTTATGGACTACAAAGACGATGACGACAAGGGATCC" FLAG linker is inserted to HindIII/BamHI site.
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJhdm2a
-
Alt nameKdm3a
-
Alt namejmjd1a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4000
-
Mutationprotein starts at aa115
-
Entrez GeneKdm3a (a.k.a. 1700105C21Rik, C230043E16Rik, JHDM2a, Jmjd1, Jmjd1a, KDM2A, TGSA, Tsga)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer BGH-rev
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4-FLAG-Jhdm2a was a gift from Toshinobu Nakamura & Toru Nakano (Addgene plasmid # 38136 ; http://n2t.net/addgene:38136 ; RRID:Addgene_38136) -
For your References section:
PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nakamura T, Liu YJ, Nakashima H, Umehara H, Inoue K, Matoba S, Tachibana M, Ogura A, Shinkai Y, Nakano T. Nature. 2012 Jun 3;486(7403):415-9. doi: 10.1038/nature11093. 10.1038/nature11093 PubMed 22722204