-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5847
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFIP200
-
Alt namefocal adhesion kinase family interacting protein of 200 kD
-
Alt nameRB1CC1
-
Alt nameRb1-inducible coiled coil protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4785
-
GenBank IDBC017556
-
Entrez GeneRB1CC1 (a.k.a. ATG17, CC1, FIP200, PPP1R131)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer GAGGAACTGCTTCCTTCACG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP-EGFP-hFIP200 was a gift from Noboru Mizushima (Addgene plasmid # 38192 ; http://n2t.net/addgene:38192 ; RRID:Addgene_38192) -
For your References section:
FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N. J Cell Biol. 2008 May 5. 181(3):497-510. 10.1083/jcb.200712064 PubMed 18443221