Skip to main content

pIS1-Actb5UTR-renilla
(Plasmid #38234)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIS1
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 3600
  • Modifications to backbone
    The original promoter was replaced with approximately 1 kb of sequence upstream of the endogenous 5' UTR for Actb.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Actb 5'UTR / Renilla
  • Alt name
    Actb
  • Species
    M. musculus (mouse)
  • Mutation
    Actb 5' UTR fused to renilla ORF
  • Entrez Gene
    Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
  • Promoter Endogenous Actb

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer gtgaccttttcggtctgctc
  • 3′ sequencing primer TGGATCATAAACTTTCGAAGTCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-Actb5UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38234 ; http://n2t.net/addgene:38234 ; RRID:Addgene_38234)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098