pIS1-Vim/Actb5UTR-renilla
(Plasmid
#38238)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIS1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 1000
-
Modifications to backboneVector promoter was replaced with genomic mouse Vim promoter (1000 nt of predicted transcriptional start site).
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVim promoter with Actb 5UTR/Renilla
-
Alt nameVim
-
Alt nameActb
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
MutationActb promoter (1000 nt upstream) and 5' UTR was replaced with the Vim promoter and first 30 nt of Actb 5' UTR
-
Entrez GeneVim
-
Entrez GeneActb (a.k.a. Actx, E430023M04Rik, beta-actin)
- Promoter Endogenous Vim
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (not destroyed)
- 3′ cloning site Nhe1 (not destroyed)
- 5′ sequencing primer gggctcgctgggtcctaggct
- 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector originally contained the mouse Actb 5' UTR followed by the renilla luciferase ORF. In the current version, the promoter and first 30 nt of the 5' UTR have been replaced by the mouse Vim promoter and first 30 nt of the Vim 5' UTR, respectively.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1-Vim/Actb5UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38238 ; http://n2t.net/addgene:38238 ; RRID:Addgene_38238) -
For your References section:
A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098