Skip to main content
Addgene

pIS1-Vim/Actb5UTR-renilla
(Plasmid #38238)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38238 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIS1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 1000
  • Modifications to backbone
    Vector promoter was replaced with genomic mouse Vim promoter (1000 nt of predicted transcriptional start site).
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Vim promoter with Actb 5UTR/Renilla
  • Alt name
    Vim
  • Alt name
    Actb
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Mutation
    Actb promoter (1000 nt upstream) and 5' UTR was replaced with the Vim promoter and first 30 nt of Actb 5' UTR
  • Entrez Gene
    Vim
  • Entrez Gene
    Actb (a.k.a. Actx, E430023M04Rik, beta-actin)
  • Promoter Endogenous Vim

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer gggctcgctgggtcctaggct
  • 3′ sequencing primer CATCCGTTTCCTTTGTTCTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector originally contained the mouse Actb 5' UTR followed by the renilla luciferase ORF. In the current version, the promoter and first 30 nt of the 5' UTR have been replaced by the mouse Vim promoter and first 30 nt of the Vim 5' UTR, respectively.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS1-Vim/Actb5UTR-renilla was a gift from David Sabatini (Addgene plasmid # 38238 ; http://n2t.net/addgene:38238 ; RRID:Addgene_38238)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098