-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Insitute
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name4EBP1
-
Alt nameEif4Ebp1
-
SpeciesR. norvegicus (rat); hybrid gene of rat and human
-
Insert Size (bp)357
-
MutationT37A, T46A, S65A, T70A (dominant negative)
-
Entrez GeneEif4ebp1 (a.k.a. PHAS-I)
- Promoter Tet ON
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ATAAGCTAGCGATGTCCGGGGGCAGCAGCTGC
- 3′ sequencing primer GGATGGATCCTTAAATGTCCATCTCAAACTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-4EBP1_4xAla was a gift from David Sabatini (Addgene plasmid # 38240 ; http://n2t.net/addgene:38240 ; RRID:Addgene_38240) -
For your References section:
A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098