-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 7300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameParkin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1398
-
GenBank IDNM_004562
-
Entrez GenePRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer aaggaaaaaagcggccgcgtaccatggcttacccatacga
- 3′ sequencing primer aaggaaaaaagcggccgcctacacgtcgaaccagtggtc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDrs.Noriyuki Matsuda & Keiji Tanaka (Tokyo Metropolitan Institute of Medical Science)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP HA-Parkin was a gift from Noboru Mizushima (Addgene plasmid # 38248 ; http://n2t.net/addgene:38248 ; RRID:Addgene_38248) -
For your References section:
Parkin mediates proteasome-dependent protein degradation and rupture of the outer mitochondrial membrane. Yoshii SR, Kishi C, Ishihara N, Mizushima N. J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18. 10.1074/jbc.M110.209338 PubMed 21454557