Skip to main content

pMXs-puro GFP-DFCP1
(Plasmid #38269)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38269 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zinc finger FYVE domain-containing protein 1
  • Alt name
    DFCP1
  • Alt name
    ZFYVE1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2300
  • GenBank ID
    NP_898977.2
  • Entrez Gene
    Zfyve1 (a.k.a. DFCP1, G630053K23, TAFF1, ZNFN2A1, mKIAA1589)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAATTAGTCAGCCATGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    IMAGE clone 6848683
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid # 38269 ; http://n2t.net/addgene:38269 ; RRID:Addgene_38269)
  • For your References section:

    Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694