pMXs-IP GFP-NBR1
(Plasmid #38283)

• Depositing Lab: Noboru Mizushima
• Publication: Itakura et al J Cell Biol. 2011 Jan 10;192(1):17-27.

Backbone

• Vector backbone: pMXs-IP
• Backbone manufacturer: Dr. Toshio Kitamura of the University of Tokyo
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6800
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Next to BRCA1 gene 1 protein
• Alt name: NBR1
• Species: H. sapiens (human)
• Insert Size (bp): 2900
• GenBank ID: D30756
• Entrez Gene: NBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (destroyed during cloning)
• 3′ cloning site: Bgl II (destroyed during cloning)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: GAGGAACTGCTTCCTTCACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kazusa Original Clone, ORK00385
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

DNA res. 1, 223-229, (1994)