-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 6800
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNext to BRCA1 gene 1 protein
-
Alt nameNBR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2900
-
GenBank IDD30756
-
Entrez GeneNBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (destroyed during cloning)
- 3′ cloning site Bgl II (destroyed during cloning)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer GAGGAACTGCTTCCTTCACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKazusa Original Clone, ORK00385
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA res. 1, 223-229, (1994)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP GFP-NBR1 was a gift from Noboru Mizushima (Addgene plasmid # 38283 ; http://n2t.net/addgene:38283 ; RRID:Addgene_38283) -
For your References section:
p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. Itakura E, Mizushima N. J Cell Biol. 2011 Jan 10;192(1):17-27. 10.1083/jcb.201009067 PubMed 21220506