pFB-CT10HF-LIC
(Plasmid
#39191)
-
Purpose(Empty Backbone) SGC Baculovirus transfer vector with C-terminal His tag and FLAG tag, preceded by a TEV protease cleavage site. Includes sites for LIC cloning, and SacB gene for negative selection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 39191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFB-CT10HF-LIC
-
Backbone manufacturerSGC
-
Vector typeBaculovirus
-
Tag
/ Fusion Protein
- TEV-His-FLAG (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Growth instructionsTransform purified plasmid in DH10Bac to generate recombinant bacmid DNA
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenone
- Promoter polyhedrin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer fBac-1 (5'-TATTCATACCGTCCCACCA-3')
- 3′ sequencing primer fBac-2 (5'-GGGAGGTTTTTTAAAGCAAGTAAA-3') (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-CT10HF-LIC was a gift from Nicola Burgess-Brown (Addgene plasmid # 39191 ; http://n2t.net/addgene:39191 ; RRID:Addgene_39191)