KCNK2
(Plasmid #73257)

• Purpose: Baculovirus expression for structure determination; may not be full ORF
• Depositing Lab: Nicola Burgess-Brown
• Publication: SGC Oxford (unpublished)

Backbone

• Vector backbone: pFB-CT10HF-LIC
• Backbone manufacturer: SGC, Addgene Plasmid #39191
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KCNK2
• Alt name: KCNK2Ac011
• Alt name: gi|14589851
• Species: H. sapiens (human)
• Insert Size (bp): 933
• Mutation: userdefined:Full_Length 1411
• Entrez Gene: KCNK2 (a.k.a. K2p2.1, TPKC1, TREK, TREK-1, TREK1, hTREK-1c, hTREK-1e)
• Promoter: Polyhedrin
• Tag / Fusion Protein:
  • TEV-His10-FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: fBac-1 (tattcataccgtcccacca)
• 3′ sequencing primer: fBac-2 (gggaggttttttaaagcaagtaaa)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use SF9 for protein expression. See also 4TWK: http://www.thesgc.org/structures/4TWK