Skip to main content

pWA PAS-E BAD K-GAFm
(Plasmid #39866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWA21 (modified)
  • Backbone manufacturer
    Wegerer, A. et al., BMC Biotechnol 8, 2 (2008)
  • Total vector size (bp) 8200
  • Modifications to backbone
    AraC protein gene and arabinose promoter with the following MCS were added after PCR amplification from the pBAD HisB plasmid (Invitrogen)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    iRFP protein PAS domain
  • Promoter rhamnose inducible
  • Tag / Fusion Protein
    • E coil (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer actggtcgtagggagaccaca
  • 3′ sequencing primer gatggagcgactcgttaatcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    iRFP protein GAF domain (mutated)
  • Mutation
    F165Y, D232Y, W308R
  • Promoter arabinose inducible
  • Tag / Fusion Protein
    • K coil (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ccataagattagcggatcctac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWA PAS-E BAD K-GAFm was a gift from Vladislav Verkhusha (Addgene plasmid # 39866 ; http://n2t.net/addgene:39866 ; RRID:Addgene_39866)
  • For your References section:

    A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions. Filonov GS, Verkhusha VV. Chem Biol. 2013 Jul 23. pii: S1074-5521(13)00242-1. doi: 10.1016/j.chembiol.2013.06.009. 10.1016/j.chembiol.2013.06.009 PubMed 23891149