pWA PAS-E BAD K-GAFm
(Plasmid
#39866)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWA21 (modified)
-
Backbone manufacturerWegerer, A. et al., BMC Biotechnol 8, 2 (2008)
- Total vector size (bp) 8200
-
Modifications to backboneAraC protein gene and arabinose promoter with the following MCS were added after PCR amplification from the pBAD HisB plasmid (Invitrogen)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameiRFP protein PAS domain
- Promoter rhamnose inducible
-
Tag
/ Fusion Protein
- E coil (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer actggtcgtagggagaccaca
- 3′ sequencing primer gatggagcgactcgttaatcg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameiRFP protein GAF domain (mutated)
-
MutationF165Y, D232Y, W308R
- Promoter arabinose inducible
-
Tag
/ Fusion Protein
- K coil (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ccataagattagcggatcctac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWA PAS-E BAD K-GAFm was a gift from Vladislav Verkhusha (Addgene plasmid # 39866 ; http://n2t.net/addgene:39866 ; RRID:Addgene_39866) -
For your References section:
A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions. Filonov GS, Verkhusha VV. Chem Biol. 2013 Jul 23. pii: S1074-5521(13)00242-1. doi: 10.1016/j.chembiol.2013.06.009. 10.1016/j.chembiol.2013.06.009 PubMed 23891149