Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPAS-E
(Plasmid #39867)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39867 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iRFP protein PAS domain
  • Promoter CMV
  • Tag / Fusion Protein
    • E coil (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Clontech
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPAS-E was a gift from Vladislav Verkhusha (Addgene plasmid # 39867 ; http://n2t.net/addgene:39867 ; RRID:Addgene_39867)
  • For your References section:

    A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions. Filonov GS, Verkhusha VV. Chem Biol. 2013 Jul 23. pii: S1074-5521(13)00242-1. doi: 10.1016/j.chembiol.2013.06.009. 10.1016/j.chembiol.2013.06.009 PubMed 23891149