Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #44272)


Item Catalog # Description Quantity Price (USD)
Plasmid 44272 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3941
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Photoactivatable iRFP1
  • Species
  • Insert Size (bp)
  • Mutation
    G127D/S141R/M163L/Q168L/A203V/G218S/R220P/V244F/A276V/Y280C/ E294V/H303R/A386V/ A480V/H498Y
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPAiRFP1-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 44272 ; ; RRID:Addgene_44272)
  • For your References section:

    Far-red light photoactivatable near-infrared fluorescent proteins engineered from a bacterial phytochrome. Piatkevich KD, Subach FV, Verkhusha VV. Nat Commun. 2013 Jul 10;4:2153. doi: 10.1038/ncomms3153. 10.1038/ncomms3153 PubMed 23842578