pEGFP-C1 hSlp2-a
(Plasmid
#40047)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSlp2-a
-
Alt nameSynaptotagmin-like protein 2-a
-
Alt nameSlp2-a WT
-
Alt nameExophilin4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2732
-
GenBank ID
-
Entrez GeneSYTL2 (a.k.a. CHR11SYT, EXO4, PPP1R151, SGA72M, SLP2, SLP2A)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCG
- 3′ sequencing primer GATGAGTTTGGACAAACCACAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOpen Biosystems cDNA clone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1 hSlp2-a was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40047 ; http://n2t.net/addgene:40047 ; RRID:Addgene_40047) -
For your References section:
Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376