pGEX4T-1 hSlp2-a del.C2AB
(Plasmid
#40059)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX4T-1
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression in BL21 with IPTG
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSlp2-a del.C2AB
-
Alt nameSynaptotagmin-like protein 2-a
-
Alt nameSlp2-a del.C2AB
-
Alt nameExophilin4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1817
-
Mutationdeletion of C2A and C2B domains (601-910)
-
GenBank IDNM_032943.3
-
Entrez GeneSYTL2 (a.k.a. CHR11SYT, EXO4, PPP1R151, SGA72M, SLP2, SLP2A)
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a known amino acid insertion (Q) at ~aa147 that does not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T-1 hSlp2-a del.C2AB was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40059 ; http://n2t.net/addgene:40059 ; RRID:Addgene_40059) -
For your References section:
Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376