-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBBRMCS5
- Backbone size w/o insert (bp) 4768
- Total vector size (bp) 6879
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namegfpmut 3.1
-
Speciesjellyfish
-
Insert Size (bp)884
Cloning Information for Gene/Insert 1
- Cloning method TOPO Cloning
- 5′ sequencing primer cttcctatctggatataagg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametauR
-
SpeciesSinorhizobium meliloti
-
Insert Size (bp)1473
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCAGTTGGGCGAGGTGAACA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametau promoter
-
SpeciesSinorhizobium meliloti
-
Insert Size (bp)157
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcggatctgcgcctgcagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GenBank accession number: JQ895027
pLMB509 contains GFPmut3.1 reporter gene downstream of the inducible promoter tauAp and a ribosomal binding site (RBS), followed by a six-His tag and a transcriptional stop codon. NdeI restriction sites flank the reporter gene, enabling the easy removal of gfpmut3.1 and subsequent replacement with the desired gene in frame.
This plasmid is compatible with BD In-Fusion cloning (Clontech) for the cloning of genes containing NdeI restriction sites
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLMB509 was a gift from Philip Poole (Addgene plasmid # 40084 ; http://n2t.net/addgene:40084 ; RRID:Addgene_40084) -
For your References section:
Regulatable vectors for environmental gene expression in alphaproteobacteria. Tett AJ, Rudder SJ, Bourdes A, Karunakaran R, Poole PS. Appl Environ Microbiol. 2012 Oct;78(19):7137-40. Epub 2012 Jul 20. 10.1128/AEM.01188-12 PubMed 22820336