pRS413-GAL1-yEGFP1
(Plasmid
#40235)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS413
- Backbone size w/o insert (bp) 5667
- Total vector size (bp) 6381
-
Vector typeBacterial Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameyEGFP1
-
Alt nameyeast Enhanced Green Fluorescent Protein
-
Insert Size (bp)714
- Promoter GAL1
-
Tag
/ Fusion Protein
- HIS3MX6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer caagactggaccatcaccaa
- 3′ sequencing primer ccctccgaaggaagactctc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Sheff MA and Thorn KS (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21(8): 661-670.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
yEGFP contains a M233I point mutation. Depositor states that this mutation does not affect yEGFP function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS413-GAL1-yEGFP1 was a gift from Michael Benton (Addgene plasmid # 40235 ; http://n2t.net/addgene:40235 ; RRID:Addgene_40235)