Skip to main content

pRS413-GAL1-yEGFP1
(Plasmid #40235)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40235 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS413
  • Backbone size w/o insert (bp) 5667
  • Total vector size (bp) 6381
  • Vector type
    Bacterial Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    yEGFP1
  • Alt name
    yeast Enhanced Green Fluorescent Protein
  • Insert Size (bp)
    714
  • Promoter GAL1
  • Tag / Fusion Protein
    • HIS3MX6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SmaI (not destroyed)
  • 5′ sequencing primer caagactggaccatcaccaa
  • 3′ sequencing primer ccctccgaaggaagactctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Sheff MA and Thorn KS (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21(8): 661-670.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

yEGFP contains a M233I point mutation. Depositor states that this mutation does not affect yEGFP function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS413-GAL1-yEGFP1 was a gift from Michael Benton (Addgene plasmid # 40235 ; http://n2t.net/addgene:40235 ; RRID:Addgene_40235)