This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40276)


Item Catalog # Description Quantity Price (USD)
Plasmid 40276 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    ATCC, Number: 77142
  • Backbone size w/o insert (bp) 4967
  • Total vector size (bp) 9860
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2, URA3, HIS3 ; MET15/17

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    LEU2 (a.k.a. YCL018W)
  • Promoter endogenous LEU2

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AACAAAGGAACCTAGAGGCC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    URA3 (a.k.a. YEL021W)
  • Promoter endogenous URA3

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GATTCGGTAATCTCCGAAC
  • 3′ sequencing primer GGCCTCTAGGTTCCTTTGTT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    MET17 (a.k.a. YLR303W, MET15, MET25)
  • Promoter endogenous MET15/17

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 3′ sequencing primer TGCTTCCGGCTCCTATGTTGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    genes were amplified by PCR from plasmids pRS425 (LEU2, ATCC Number:77106), p426GPD (URA3, ATCC Number:87361) and pRS411 (MET15/17, ATCC Number:87474)
  • Terms and Licenses
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLUM was a gift from Markus Ralser (Addgene plasmid # 40276)
  • For your References section:

    A prototrophic deletion mutant collection for yeast metabolomics and systems biology. Mulleder M, Capuano F, Pir P, Christen S, Sauer U, Oliver SG, Ralser M. Nat Biotechnol. 2012 Dec 7;30(12):1176-8. doi: 10.1038/nbt.2442. 10.1038/nbt.2442 PubMed 23222782