-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBad-modified
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 4800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameddGFP-A
-
SpeciesSynthetic
-
Insert Size (bp)700
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDDGFP-A was a gift from Robert Campbell (Addgene plasmid # 40286 ; http://n2t.net/addgene:40286 ; RRID:Addgene_40286) -
For your References section:
Dimerization-dependent green and yellow fluorescent proteins. Alford SC, Ding Y, Simmen T, Campbell RE. ACS Synth Biol. 2012 Dec 21;1(12):569-75. doi: 10.1021/sb300050j. Epub 2012 Aug 14. 10.1021/sb300050j PubMed 23656278