pCGN-BCL-6Δ (pCGN-BCL6-delta)
(Plasmid
#40338)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCGN
-
Backbone manufacturerMasafumi Tanaka and Winship Herr (PMID: 2302733)
- Backbone size w/o insert (bp) 7500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBCL-6Δ
-
Alt nameBCL6Δ
-
Alt nameBCL-6
-
Alt nameBCL6
-
SpeciesH. sapiens (human)
-
MutationMissing four of six zinc fingers (see note below); contains aa 1-595
-
GenBank IDNM_001706.4 NM_001130845.1
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The expression plasmid pCGN-BCL-6Δ was constructed by digesting the BCL-6 cDNA with EcoRI, deleting the 3' region, and cloning the remaining cDNA into pCGN. The BCL-6Δ is missing four of six zinc fingers and does not bind to a consensus BCL-6 probe in a gel shift assay (A. L. Dent, unpublished data).
Note, the cloning and ligation adds the following residues after aa595 of BCL6: RYQAYRYRRPGYR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCGN-BCL-6Δ (pCGN-BCL6-delta) was a gift from Alexander Dent (Addgene plasmid # 40338 ; http://n2t.net/addgene:40338 ; RRID:Addgene_40338) -
For your References section:
BCL-6 regulates chemokine gene transcription in macrophages. Toney LM, Cattoretti G, Graf JA, Merghoub T, Pandolfi PP, Dalla-Favera R, Ye BH, Dent AL. Nat Immunol. 2000 Sep;1(3):214-20. 10.1038/79749 PubMed 10973278