CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
(Plasmid
#40347)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCXN2
-
Backbone manufacturerNiwa, Yamamura, and Miyazaki (PMID: 1660837)
- Backbone size w/o insert (bp) 5200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCL-6 ZFΔ
-
Alt nameBCL-6
-
SpeciesH. sapiens (human)
-
MutationContains aa1-504; ZF domain deleted (see note below)
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter pCAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CXN-BCL-6 ZF deletion was made by digesting pBS-BCL-6FL with AspI, which cleaves a unique site in the human BCL-6 cDNA 45 bp before the start of the ZF domain, and HindIII, which cleaves the pBS vector. The digested plasmid was separated from the smaller deleted fragment, and ligated. The truncated cDNA was then cloned into pCXN2 via SalI and XhoI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel) was a gift from Alexander Dent (Addgene plasmid # 40347 ; http://n2t.net/addgene:40347 ; RRID:Addgene_40347) -
For your References section:
Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517