This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40359)


Item Catalog # Description Quantity Price (USD)
Plasmid 40359 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Modifications to backbone
    pcLINK is derived from pCAbeta (Doug Martin lab - Fukuchi et al., 1993) in which the beta-gal sequence NotI-ClaI has been removed and the MCS sequence GGCCGTCTCAGGCCGCCCGGGCGGATCCATTTAAATCTCGAGACT AGTATCGAT (XmaI-SmaI-BamHI-DraI-XhoI-SpeI-ClaI) was inserted.
  • Vector type
    chick expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    drebrin E2
  • Species
    H. sapiens (human)
  • Entrez Gene
    DBN1 (a.k.a. D0S117E)
  • Promoter chick B-actin promoter with CMV enhancer
  • Tag / Fusion Protein
    • eYFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    drebrin-YFP was a gift from Phillip Gordon-Weeks (Addgene plasmid # 40359 ; ; RRID:Addgene_40359)
  • For your References section:

    Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is required for neuritogenesis. Geraldo S, Khanzada UK, Parsons M, Chilton JK, Gordon-Weeks PR. Nat Cell Biol. 2008 Oct;10(10):1181-9. Epub 2008 Sep 21. 10.1038/ncb1778 PubMed 18806788