Skip to main content
Addgene
Open Menu

drebrin-YFP
(Plasmid #40359)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40359 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 40359-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 40359-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    EYFP-N1
  • Backbone manufacturer
    Clontech
  • Modifications to backbone
    pcLINK is derived from pCAbeta (Doug Martin lab - Fukuchi et al., 1993) in which the beta-gal sequence NotI-ClaI has been removed and the MCS sequence GGCCGTCTCAGGCCGCCCGGGCGGATCCATTTAAATCTCGAGACT AGTATCGAT (XmaI-SmaI-BamHI-DraI-XhoI-SpeI-ClaI) was inserted.
  • Vector type
    chick expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    drebrin E2
  • Species
    H. sapiens (human)
  • Entrez Gene
    DBN1 (a.k.a. D0S117E)
  • Promoter chick B-actin promoter with CMV enhancer
  • Tag / Fusion Protein
    • eYFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    drebrin-YFP was a gift from Phillip Gordon-Weeks (Addgene plasmid # 40359 ; http://n2t.net/addgene:40359 ; RRID:Addgene_40359)

  • For your References section:

    Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is required for neuritogenesis. Geraldo S, Khanzada UK, Parsons M, Chilton JK, Gordon-Weeks PR. Nat Cell Biol. 2008 Oct;10(10):1181-9. Epub 2008 Sep 21. 10.1038/ncb1778 PubMed 18806788
Related items:
Commonly requested with: