Skip to main content

pET-HIS-Sangamo
(Plasmid #40786)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40786 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pET-28b
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 3880
  • Total vector size (bp) 5913
  • Modifications to backbone
    Addition of TALEN with +63 C Terminus and FokI Endonuclease. Includes 6xHis tag on N terminal of insert
  • Vector type
    Bacterial Expression, TALEN
  • Selectable markers
    XGAL/IPTG

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB + Antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Transcription Activator Like Effector Nuclease
  • Alt name
    TALEN
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    2033
  • Mutation
    +63 C Terminus, Codon Optimized FokI Endonuclease
  • Promoter T7
  • Tag / Fusion Protein
    • N Terminal 6xHIS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
  • 3′ sequencing primer CGTCCACCAAGACATGCCAAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 40786" in your Materials and Methods section.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-HIS-Sangamo was a gift from Gang Bao (Addgene plasmid # 40786 ; http://n2t.net/addgene:40786 ; RRID:Addgene_40786)