Skip to main content

pFBOT563
(Plasmid #40864)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40864 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 8000
  • Vector type
    Bacterial Expression, Insect Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oxytocin promoter
  • Alt name
    Oxt
  • Promoter mouse oxytocin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
  • 3′ sequencing primer aagtttaacaacaacaattgca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The following mutations are known and do not effect function:
missing A at 6292, C6409T, A insert at 6399, C6398T, C insert at 5338, A4856C.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOT563 was a gift from Harold Gainer (Addgene plasmid # 40864 ; http://n2t.net/addgene:40864 ; RRID:Addgene_40864)
  • For your References section:

    Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo. Fields RL, Ponzio TA, Kawasaki M, Gainer H. PLoS One. 2012;7(2):e32085. Epub 2012 Feb 21. 10.1371/journal.pone.0032085 PubMed 22363799