-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 8000
-
Vector typeBacterial Expression, Insect Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOxytocin promoter
-
Alt nameOxt
- Promoter mouse oxytocin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
- 3′ sequencing primer aagtttaacaacaacaattgca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The following mutations are known and do not effect function:
missing A at 6292, C6409T, A insert at 6399, C6398T, C insert at 5338, A4856C.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBOT563 was a gift from Harold Gainer (Addgene plasmid # 40864 ; http://n2t.net/addgene:40864 ; RRID:Addgene_40864) -
For your References section:
Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo. Fields RL, Ponzio TA, Kawasaki M, Gainer H. PLoS One. 2012;7(2):e32085. Epub 2012 Feb 21. 10.1371/journal.pone.0032085 PubMed 22363799