Skip to main content

pCMV-EGFP-T2A-ACREB-WPRE
(Plasmid #40867)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40867 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ACREB
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
  • 3′ sequencing primer aagtttaacaacaacaattgca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are a A-4779GT and GG5808TT mutations which do not effect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-EGFP-T2A-ACREB-WPRE was a gift from Harold Gainer (Addgene plasmid # 40867 ; http://n2t.net/addgene:40867 ; RRID:Addgene_40867)
  • For your References section:

    Effects of A-CREB, a dominant negative inhibitor of CREB, on the expression of c-fos and other immediate early genes in the rat SON during hyperosmotic stimulation in vivo. Lubelski D, Ponzio TA, Gainer H. Brain Res. 2012 Jan 6;1429:18-28. Epub 2011 Oct 26. 10.1016/j.brainres.2011.10.033 PubMed 22079318