pCMV-EGFP-T2A-ACREB-WPRE
(Plasmid
#40867)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac1
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACREB
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer CCTTGCTGTTCTTCTACGGCA
- 3′ sequencing primer aagtttaacaacaacaattgca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are a A-4779GT and GG5808TT mutations which do not effect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-EGFP-T2A-ACREB-WPRE was a gift from Harold Gainer (Addgene plasmid # 40867 ; http://n2t.net/addgene:40867 ; RRID:Addgene_40867) -
For your References section:
Effects of A-CREB, a dominant negative inhibitor of CREB, on the expression of c-fos and other immediate early genes in the rat SON during hyperosmotic stimulation in vivo. Lubelski D, Ponzio TA, Gainer H. Brain Res. 2012 Jan 6;1429:18-28. Epub 2011 Oct 26. 10.1016/j.brainres.2011.10.033 PubMed 22079318