Skip to main content

pCS2+8CmOrange
(Plasmid #40882)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone manufacturer
    Turner and Weintraub (1994)
  • Backbone size (bp) 4095
  • Modifications to backbone
    Four 8bp cutter restriction enzymes (AscI, PacI, FseI, AsiSI) were introduced.
  • Vector type
    Sea urchin, zebrafish, Xenopus
  • Promoter SP6
  • Tag / Fusion Protein
    • mOrange (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CTTGATTTAGGTGACACTATAG
  • 3′ sequencing primer TGTTGTTAACTTGTTTATTGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+8CmOrange was a gift from Amro Hamdoun (Addgene plasmid # 40882 ; http://n2t.net/addgene:40882 ; RRID:Addgene_40882)
  • For your References section:

    Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201