pKXUa1-HA-ATBF1
(Plasmid
#40926)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKXUa1
-
Backbone manufacturerKaiming Xu (Emory University)
- Backbone size w/o insert (bp) 6750
- Total vector size (bp) 19000
-
Modifications to backbonea linker containing HA-tag was inserted
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATBF1
-
Alt nameZFHX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)11112
-
GenBank IDL32832.1 AAC14462.1
-
Entrez GeneZFHX3 (a.k.a. ATBF1, ATBT, ATFB8, C16orf47, SCA4, ZFH-3, ZNF927)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer GCAAATGGGCGGTAGGCGTGTA
- 3′ sequencing primer GACCTTGCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKXUa1-HA-ATBF1 was a gift from Jin-Tang Dong (Addgene plasmid # 40926 ; http://n2t.net/addgene:40926 ; RRID:Addgene_40926) -
For your References section:
ATBF1 inhibits estrogen receptor (ER) function by selectively competing with AIB1 for binding to the ER in ER-positive breast cancer cells. Dong XY, Sun X, Guo P, Li Q, Sasahara M, Ishii Y, Dong JT. J Biol Chem. 2010 Oct 22;285(43):32801-9. Epub 2010 Aug 18. 10.1074/jbc.M110.128330 PubMed 20720010