pKXUa1-HA-ATBF1
(Plasmid #40926)

• Depositing Lab: Jin-Tang Dong
• Publication: Dong et al J Biol Chem. 2010 Oct 22;285(43):32801-9. Epub 2010 Aug 18.

Backbone

• Vector backbone: pKXUa1
• Backbone manufacturer: Kaiming Xu (Emory University)
• Backbone size w/o insert (bp): 6750
• Total vector size (bp): 19000
• Modifications to backbone: a linker containing HA-tag was inserted
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ATBF1
• Alt name: ZFHX3
• Species: H. sapiens (human)
• Insert Size (bp): 11112
• GenBank ID: L32832.1 AAC14462.1
• Entrez Gene: ZFHX3 (a.k.a. ATBF1, ATBT, ATFB8, C16orf47, SCA4, ZFH-3, ZNF927)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: GCAAATGGGCGGTAGGCGTGTA
• 3′ sequencing primer: GACCTTGCATTCCTTTGGCGAGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry