Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MSCV-N-Flag-HA-GFP
(Plasmid #41034)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41034 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-N-Flag-HA-IRES-PURO
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Mammalian Expression, Retroviral ; Gateway Destination vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    Green Fluorescent Protein
  • Species
    A. victoria
  • Insert Size (bp)
    715
  • Promoter LTR-driven expression
  • Tags / Fusion Proteins
    • Flag (N terminal on backbone)
    • HA (N terminal on backbone)
    • IRES Puro (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Harper-MSCV (CAGCCCTCACTCCTTCTCTAGG)
  • 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-N-Flag-HA-GFP was a gift from Wade Harper (Addgene plasmid # 41034 ; http://n2t.net/addgene:41034 ; RRID:Addgene_41034)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732