Skip to main content

FUW-TetO-Wt1
(Plasmid #41082)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41082 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUW-TetO
  • Backbone size w/o insert (bp) 8339
  • Total vector size (bp) 9839
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wt1 (-KTS alternative isoform)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1500
  • Entrez Gene
    Wt1 (a.k.a. D630046I19Rik, Wt-1)
  • Promoter TetO + minimal CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGC CTG GAG ACG CCA TCC ACG CTG
  • 3′ sequencing primer AGA ATA CCA GTC AAT CTT TCA C
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The WT1 ORF in this plasmid was cloned from a testicular extract using the following primers:
forward: CTGGACTTCCTCCTGTCGCAGCAG
reverse: TCAAAGCGCCAGCTGGAGTTTGGT

The Wt1 gene contains a -KTS isoform that is shorter than the known one. This is not just a deletion but rather a real alternative isoform.

When compared to the most recent GenBank reference sequence NP_659032.2 the WT1 isoform in this plasmid does not contain amino acids 16-63.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-TetO-Wt1 was a gift from Rudolf Jaenisch (Addgene plasmid # 41082 ; http://n2t.net/addgene:41082 ; RRID:Addgene_41082)
  • For your References section:

    Direct Reprogramming of Fibroblasts into Embryonic Sertoli-like Cells by Defined Factors. Buganim Y, Itskovich E, Hu YC, Cheng AW, Ganz K, Sarkar S, Fu D, Welstead GG, Page DC, Jaenisch R. Cell Stem Cell. 2012 Sep 7;11(3):373-86. 10.1016/j.stem.2012.07.019 PubMed 22958931