-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUW-TetO
- Backbone size w/o insert (bp) 8339
- Total vector size (bp) 9839
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWt1 (-KTS alternative isoform)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1500
-
Entrez GeneWt1 (a.k.a. D630046I19Rik, Wt-1)
- Promoter TetO + minimal CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGC CTG GAG ACG CCA TCC ACG CTG
- 3′ sequencing primer AGA ATA CCA GTC AAT CTT TCA C (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The WT1 ORF in this plasmid was cloned from a testicular extract using the following primers:
forward: CTGGACTTCCTCCTGTCGCAGCAG
reverse: TCAAAGCGCCAGCTGGAGTTTGGT
The Wt1 gene contains a -KTS isoform that is shorter than the known one. This is not just a deletion but rather a real alternative isoform.
When compared to the most recent GenBank reference sequence NP_659032.2 the WT1 isoform in this plasmid does not contain amino acids 16-63.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-TetO-Wt1 was a gift from Rudolf Jaenisch (Addgene plasmid # 41082 ; http://n2t.net/addgene:41082 ; RRID:Addgene_41082) -
For your References section:
Direct Reprogramming of Fibroblasts into Embryonic Sertoli-like Cells by Defined Factors. Buganim Y, Itskovich E, Hu YC, Cheng AW, Ganz K, Sarkar S, Fu D, Welstead GG, Page DC, Jaenisch R. Cell Stem Cell. 2012 Sep 7;11(3):373-86. 10.1016/j.stem.2012.07.019 PubMed 22958931