Skip to main content

pBabe(SV40)-Cytochrome C-GFP
(Plasmid #41184)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5330
  • Modifications to backbone
    Puromycin resistance gene was cut out with HindIII and ClaI, and replaced with Cytochrome C-GFP fragment
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cytochrome C-GFP
  • Alt name
    cytog
  • Species
    M. musculus (mouse)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer accctaactgacacacattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe(SV40)-Cytochrome C-GFP was a gift from Douglas Green (Addgene plasmid # 41184 ; http://n2t.net/addgene:41184 ; RRID:Addgene_41184)
  • For your References section:

    The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, Green DR. Nat Cell Biol. 2000 Mar;2(3):156-62. 10.1038/35004029 PubMed 10707086