pBabe(SV40)-Cytochrome C-GFP
(Plasmid
#41184)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5330
-
Modifications to backbonePuromycin resistance gene was cut out with HindIII and ClaI, and replaced with Cytochrome C-GFP fragment
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCytochrome C-GFP
-
Alt namecytog
-
SpeciesM. musculus (mouse)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer ctttatccagccctcac
- 3′ sequencing primer accctaactgacacacattcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabe(SV40)-Cytochrome C-GFP was a gift from Douglas Green (Addgene plasmid # 41184 ; http://n2t.net/addgene:41184 ; RRID:Addgene_41184) -
For your References section:
The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, Green DR. Nat Cell Biol. 2000 Mar;2(3):156-62. 10.1038/35004029 PubMed 10707086