pCEF-VSV-G
(Plasmid
#41792)
-
PurposeVSV-G-expressing envelope plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUMVC3
-
Backbone manufacturerAldevron
- Total vector size (bp) 6251
-
Modifications to backboneHybrid CEF promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVesicular stomatitis virus G glycoprotein, Indiana strain
- Promoter CEF
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer taccgggcgccgtccaggcacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEF-VSV-G was a gift from Jakob Reiser (Addgene plasmid # 41792 ; http://n2t.net/addgene:41792 ; RRID:Addgene_41792) -
For your References section:
Specific targeting of human interleukin (IL)-13 receptor alpha2-positive cells with lentiviral vectors displaying IL-13. Ou W, Marino MP, Suzuki A, Joshi B, Husain SR, Maisner A, Galanis E, Puri RK, Reiser J. Hum Gene Ther Methods. 2012 Apr;23(2):137-47. Epub 2012 May 21. 10.1089/hgtb.2012.054 PubMed 22612657