Skip to main content

pCEF-VSV-G
(Plasmid #41792)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 41792 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUMVC3
  • Backbone manufacturer
    Aldevron
  • Total vector size (bp) 6251
  • Modifications to backbone
    Hybrid CEF promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vesicular stomatitis virus G glycoprotein, Indiana strain
  • Promoter CEF

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer taccgggcgccgtccaggcacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEF-VSV-G was a gift from Jakob Reiser (Addgene plasmid # 41792 ; http://n2t.net/addgene:41792 ; RRID:Addgene_41792)
  • For your References section:

    Specific targeting of human interleukin (IL)-13 receptor alpha2-positive cells with lentiviral vectors displaying IL-13. Ou W, Marino MP, Suzuki A, Joshi B, Husain SR, Maisner A, Galanis E, Puri RK, Reiser J. Hum Gene Ther Methods. 2012 Apr;23(2):137-47. Epub 2012 May 21. 10.1089/hgtb.2012.054 PubMed 22612657