psiCheck-ApoECDS
(Plasmid
#41848)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePsiCheck2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
- Total vector size (bp) 6400
-
Modifications to backboneThe CDS of ApoE is chimerically fused to the C terminus of the renilla luciferase reporter in the psiCheck2 vector by removing the luciferase stop codon and inserting a 6 amino acid-long linker connecting the CDS of luciferase to the CDS of ApoE.
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameApoE CDS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)954
-
GenBank IDNM_000041
-
Entrez GeneAPOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
-
Tag
/ Fusion Protein
- renilla luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTACATCAAGAGCTTCGTGG
- 3′ sequencing primer AAGACTCATTTAGATCCTCACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCheck-ApoECDS was a gift from Sohail Tavazoie (Addgene plasmid # 41848 ; http://n2t.net/addgene:41848 ; RRID:Addgene_41848) -
For your References section:
Convergent Multi-miRNA Targeting of ApoE Drives LRP1/LRP8-Dependent Melanoma Metastasis and Angiogenesis. Pencheva N, Tran H, Buss C, Huh D, Drobnjak M, Busam K, Tavazoie SF. Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8. 10.1016/j.cell.2012.10.028 PubMed 23142051