pcDNA5/FRT/TO/FLAG-HA-SBP-TNRC6A
(Plasmid
#42044)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA5/FRT/TO/FLAG-HA-SBP
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 10499
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNRC6A
-
Alt nameGW182
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5130
-
GenBank IDAAK62026.1
-
Entrez GeneTNRC6A (a.k.a. CAGH26, FAME6, GW1, GW182, TNRC6)
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- HA (N terminal on backbone)
- SBP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO/FLAG-HA-SBP-TNRC6A was a gift from Kumiko Ui-Tei (Addgene plasmid # 42044 ; http://n2t.net/addgene:42044 ; RRID:Addgene_42044) -
For your References section:
Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874