pMALp2x-SCO5461
(Plasmid
#42507)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMAL-p2x
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6715
- Total vector size (bp) 7330
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Growth instructionsUse rich media (terrific broth, etc.) for protein expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameguanosine ADP-ribosyltransferase
-
Alt nameSCO5461
-
Alt nameScARP
-
Alt nameNAD+:guanine-N2-ADP-D-ribosyltransferase
-
SpeciesStreptomyces coelicolor A3(2)
-
Insert Size (bp)615
-
GenBank IDAL939123.1:267130..267744 CAB76015.1
-
Entrez GeneSCO5461 (a.k.a. SCO5461, SC3D11.18)
- Promoter tac
-
Tag
/ Fusion Protein
- maltose-binding protein (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer ggtcgtcagactgtcgatgaagcc
- 3′ sequencing primer gtaaaacgacggccag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMALp2x-SCO5461 was a gift from Koji Okamoto (Addgene plasmid # 42507 ; http://n2t.net/addgene:42507 ; RRID:Addgene_42507) -
For your References section:
ADP-ribosylation of guanosine by SCO5461 protein secreted from Streptomyces coelicolor. Nakano T, Matsushima-Hibiya Y, Yamamoto M, Takahashi-Nakaguchi A, Fukuda H, Ono M, Takamura-Enya T, Kinashi H, Totsuka Y. Toxicon. 2012 Dec 2;63C:55-63. doi: 10.1016/j.toxicon.2012.11.019. 10.1016/j.toxicon.2012.11.019 PubMed 23212047