Skip to main content

pLHCX-Flag-mPKM1
(Plasmid #42511)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42511 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLHCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6800
  • Total vector size (bp) 8400
  • Vector type
    Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pyruvate Kinase M1
  • Alt name
    PKM1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Lewis C. Cantley, Heather R. Christofk, Matthew G. Vander Heiden
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid constructed by Heather Christofk in Lew Cantley's Lab. Ref: Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E., Wei, R., Fleming, M. D., et al. (2008). The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature, 452(7184), 230–233. doi:10.1038/nature06734

The depositing scientist notes: NM_011099.3 is PKM2 and NM_001253883.1 is PKM1, based on sequence homology of the respective translated products to the human PKM isoforms. The isoform annotations in the corresponding GeneBank entries are incorrect.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLHCX-Flag-mPKM1 was a gift from Dimitrios Anastasiou (Addgene plasmid # 42511 ; http://n2t.net/addgene:42511 ; RRID:Addgene_42511)
  • For your References section:

    Inhibition of pyruvate kinase M2 by reactive oxygen species contributes to cellular antioxidant responses. Anastasiou D, Poulogiannis G, Asara JM, Boxer MB, Jiang JK, Shen M, Bellinger G, Sasaki AT, Locasale JW, Auld DS, Thomas CJ, Vander Heiden MG, Cantley LC. Science. 2011 Dec 2;334(6060):1278-83. doi: 10.1126/science.1211485. Epub 2011 Nov 3. 10.1126/science.1211485 PubMed 22052977