-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLHCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6800
- Total vector size (bp) 8400
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePyruvate Kinase M1
-
Alt namePKM1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1600
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLewis C. Cantley, Heather R. Christofk, Matthew G. Vander Heiden
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid constructed by Heather Christofk in Lew Cantley's Lab. Ref: Christofk, H. R., Vander Heiden, M. G., Harris, M. H., Ramanathan, A., Gerszten, R. E., Wei, R., Fleming, M. D., et al. (2008). The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature, 452(7184), 230–233. doi:10.1038/nature06734
The depositing scientist notes: NM_011099.3 is PKM2 and NM_001253883.1 is PKM1, based on sequence homology of the respective translated products to the human PKM isoforms. The isoform annotations in the corresponding GeneBank entries are incorrect.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLHCX-Flag-mPKM1 was a gift from Dimitrios Anastasiou (Addgene plasmid # 42511 ; http://n2t.net/addgene:42511 ; RRID:Addgene_42511) -
For your References section:
Inhibition of pyruvate kinase M2 by reactive oxygen species contributes to cellular antioxidant responses. Anastasiou D, Poulogiannis G, Asara JM, Boxer MB, Jiang JK, Shen M, Bellinger G, Sasaki AT, Locasale JW, Auld DS, Thomas CJ, Vander Heiden MG, Cantley LC. Science. 2011 Dec 2;334(6060):1278-83. doi: 10.1126/science.1211485. Epub 2011 Nov 3. 10.1126/science.1211485 PubMed 22052977