-
PurposeExpression of GFP tagged PKM2 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6310
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePKM2
-
Alt namePKM transcript variant 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1610
-
GenBank IDNM_002654
-
Entrez GenePKM (a.k.a. CTHBP, HEL-S-30, OIP3, PK3, PKM2, TCB, THBP1, p58)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTGGAG
- 3′ sequencing primer TGCATTCATTTTATGTTTCAGGTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-PKM2 was a gift from Axel Ullrich (Addgene plasmid # 64698 ; http://n2t.net/addgene:64698 ; RRID:Addgene_64698) -
For your References section:
Nuclear translocation of the tumor marker pyruvate kinase M2 induces programmed cell death. Stetak A, Veress R, Ovadi J, Csermely P, Keri G, Ullrich A. Cancer Res. 2007 Feb 15;67(4):1602-8. 10.1158/0008-5472.CAN-06-2870 PubMed 17308100