-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 12500
-
Modifications to backboneeGFP replaced by mCherry (Sal I / Not I)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameankyrin G
-
Alt nameANK3
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)8500
-
GenBank ID
-
Entrez GeneAnk3 (a.k.a. ANK-3)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATTTCCAAGTCTCCACC
- 3′ sequencing primer GACAAACCACAACTAGAATGCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVann Bennett, Duke University, Durham, North Carolina, USA
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ankG-mCherry was a gift from Benedicte Dargent (Addgene plasmid # 42566 ; http://n2t.net/addgene:42566 ; RRID:Addgene_42566) -
For your References section:
End-binding proteins EB3 and EB1 link microtubules to ankyrin G in the axon initial segment. Leterrier C, Vacher H, Fache MP, d'Ortoli SA, Castets F, Autillo-Touati A, Dargent B. Proc Natl Acad Sci U S A. 2011 May 24;108(21):8826-31. doi: 10.1073/pnas.1018671108. Epub 2011 May 6. 10.1073/pnas.1018671108 PubMed 21551097