Skip to main content
Addgene

ankG-mCherry
(Plasmid #42566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 12500
  • Modifications to backbone
    eGFP replaced by mCherry (Sal I / Not I)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ankyrin G
  • Alt name
    ANK3
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    8500
  • GenBank ID
  • Entrez Gene
    Ank3 (a.k.a. ANK-3)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GATTTCCAAGTCTCCACC
  • 3′ sequencing primer GACAAACCACAACTAGAATGCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vann Bennett, Duke University, Durham, North Carolina, USA
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ankG-mCherry was a gift from Benedicte Dargent (Addgene plasmid # 42566 ; http://n2t.net/addgene:42566 ; RRID:Addgene_42566)
  • For your References section:

    End-binding proteins EB3 and EB1 link microtubules to ankyrin G in the axon initial segment. Leterrier C, Vacher H, Fache MP, d'Ortoli SA, Castets F, Autillo-Touati A, Dargent B. Proc Natl Acad Sci U S A. 2011 May 24;108(21):8826-31. doi: 10.1073/pnas.1018671108. Epub 2011 May 6. 10.1073/pnas.1018671108 PubMed 21551097