Skip to main content
Addgene
Open Menu

pCAG-AILR-LplA-ER
(Plasmid #42574)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42574 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 42574-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 42574-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4261
  • Total vector size (bp) 7786

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LplA(AILR) with ER-retention sequence KDEL
  • Species
    E. coli
  • Mutation
    Compared to wild-type LplA: tryptophan 37 to alanine; threonine 57 to isoleucine; phenylalanine 147 to leucine; histidine 267 to arginine
  • Promoter CAG
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCCGCCGTCCCCTTCTCCATCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-AILR-LplA-ER was a gift from Alice Ting (Addgene plasmid # 42574 ; http://n2t.net/addgene:42574 ; RRID:Addgene_42574)

  • For your References section:

    Quantum Dot Targeting with Lipoic Acid Ligase and HaloTag for Single-Molecule Imaging on Living Cells. Liu DS, Phipps WS, Loh KH, Howarth M, Ting AY. ACS Nano. 2012 Dec 21;6(12):11080-7. doi: 10.1021/nn304793z. Epub 2012 Dec 5. 10.1021/nn304793z PubMed 23181687
Related items:
Commonly requested with: