Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXL-CAG-LAP2-NLG1
(Plasmid #43924)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43924 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 6389
  • Total vector size (bp) 8978
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LAP-NLG1
  • Alt name
    Neuroligin1
  • Species
    R. norvegicus (rat)
  • Promoter Chicken Beta Actin

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCCCCTCTAGCGGGCGCGG
  • 3′ sequencing primer TGTGAGCCAGGGCATTGGCCACACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXL-CAG-LAP2-NLG1 was a gift from Alice Ting (Addgene plasmid # 43924 ; http://n2t.net/addgene:43924 ; RRID:Addgene_43924)
  • For your References section:

    Imaging trans-cellular neurexin-neuroligin interactions by enzymatic probe ligation. Liu DS, Loh KH, Lam SS, White KA, Ting AY. PLoS One. 2013;8(2):e52823. doi: 10.1371/journal.pone.0052823. Epub 2013 Feb 14. 10.1371/journal.pone.0052823 PubMed 23457442