-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4
-
Backbone manufacturerPromega
- Total vector size (bp) 5672
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional article reference: doi: 10.1111/gtc.12037
For more information on Yamamoto TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALEN/Yamamotolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-SSA was a gift from Takashi Yamamoto (Addgene plasmid # 42962) -
For your References section:
Targeted mutagenesis in the sea urchin embryo using zinc-finger nucleases. Ochiai H, Fujita K, Suzuki K, Nishikawa M, Shibata T, Sakamoto N, Yamamoto T. Genes Cells. 2010 Aug;15(8):875-85. doi: 10.1111/j.1365-2443.2010.01425.x. Epub 2010 Jul 2. 10.1111/j.1365-2443.2010.01425.x PubMed 20604805